Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD159D10
Clone ID 3SD159D10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD159D10
Sequence
CTGATGGCCCCCAAGTATGGTTNNNCAAGGTTCTGTGTCTACCTCCCACCCCCAGTCACTTGGCTGTGAGAGCCGTGACA
GCAGATACATGGGTGCCTTTTGTGACCCTATAGCATTAACTTCCTGGTAGCTTTCCTCCAAACTGTGGAGGTGGAGGGAC
CTGGTCCCTATGGTGCCTGTCTGGCGTTTTCACCCTGTGACAGTGGTGATTTGGATTCTGGCCATGATGCTAAACCGTCA
CGTCTTTTTTGCAGATGTTGATGCCTAAGAAGAATCGGATTGCCATCTACGAACTCCTTTTTAAGGAGGGCGTGATGGTC
GCCAAAAAGGATGTCCACATGCCTAAGCACCCGGAGCTGGCAGACAAAAATGTGCCCAACCTTCATGTAATGAAGGCCAT
GCAGGTGTGGAGAGGGACACAGGTGGGAATAGGTCTGCCCTTCCCGAGGAGCCAGCTGCTGACTGACATGTGTCTATGGT
CCTGCAGTCTCTCAAGTCTCGAGGCTACGTGAAGGAACAGTTTGCTTGGAGACATTTCTACTGGTACCTTACGAACGAGG
GCATCCAGTATCTCCGAGACTACCTGCACCTACCCCCGGAGATCGTGCCCGCCACCCTGCGTCGCAGCCGTCCCGAGACC
GGCAGGCCTC
Sequence Type genomic DNA
Unitrap ID UNI15429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27771026..27771673 636
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052146 (Rps10) NM_025963 ribosomal protein S10 Gene [Source:MGI (curated);Acc:Rps10-003]

 
Come back to gene ENSMUSG00000052146


For any suggestions or comments, please send an email to unitrap@crg.es