Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP105E11
Clone ID 3SP105E11
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SP105E11
Sequence
CAGCTACTGCGGTACTTACTCTAATTAGGGAAGAAGTTGGCGAAGTCCTGTGTCTGGGTAGCCACTGAGAGATGCTGGGA
ACCACTGAGACTTCTCTCTCCAAGCACTAGAGGCATTGGTTGCAGCATGTAGAGAGTCCTGGTGGTGTCCAGTGTCAGGT
GATCAGGGATTCTCAAATCAATATGTGAGATCACAAAATCAGTAGTACTTCAAATGATAGCCATAATCTAAAGTGAAGTT
TGGATGACGTGAGAGAAAATGAGTTGTTTTATGGTAGTTTATGAGGCGCTGTCGCCTGCTTTGGGGCTTTTTTGCCTTTT
CTTTCCTTTATAGCTTGTCCCCAATTCCTGCCTCTTTCTAGACTGCATTGCTAGTAATTGCTGAAAGGCCAGAGCAAAGG
CAAGACGAGATTTTTAACATCTTACTGACTTGTGTGTTACCTGCAGAATGACACAGTAACCATCCGGACCAGGAAGTTCA
TGACCAACCGTCTGCTTCAGAGGAAACAGATGGTAAGGATCAGAGTCAAAATGTGGTCTTTGTGTCTGCTTTTGAAGATG
TAGTTAACTTGTAAGGAGTACTGACTCTTACACCTCTTTTATAGTCATTGATGTCCTTCATCCTGGGAAAGGCACAGTAC
CAAAGACAG
Sequence Type genomic DNA
Unitrap ID UNI12979

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25310526..25311174 636
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025290 (Rps24) NM_011297 ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

 
Come back to gene ENSMUSG00000025290


For any suggestions or comments, please send an email to unitrap@crg.es