Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD154G10
Clone ID 5SD154G10
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD154G10
Sequence
AAATCGTCTCAGACTAGGAAGGCTGAAGCTAGGATTAAAATCTACCGAGAAGGT
Sequence Type genomic DNA
Unitrap ID UNI11427

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48310878..48310931 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es