Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD151H04
Clone ID 3SD151H04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD151H04
Sequence
TAACTAAATAAAAGCAGAGTGAAAAGGAAAGCAATCTGAAATATTCCTCATTTTTCACATATCTTAAATTACTTTCTTAT
ACCTTTACAACCTTCTTTTACACAATTTAAATTATTTTCTGACACCCTCACAGCTTTTTTAATGTTTCACATCCTCAGGC
CTTTACAACTTGCAATTACATACATTAAATTACTTTCTTAG
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100445672..100445872 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es