Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD151E03
Clone ID 5SD151E03
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD151E03
Sequence
GTTTGGGTTTGGNTTTTTGGGTTTTTTTTTTTTTTTTTTTGAGACAGGGTTTTTCTGTATAGCCCTGGGTGTCCTGGAAC
TCACTCTGTAGACCAGGCTGGCTTCGAACTCAGAAATCCACCTGCCTCTGCCTCCTGAGTGCTGGGATTAAAGGCGTATT
CCCATGTCCGGCTGTATTCTTTTTTTTAAAAAAATTTTTTTAAATTTATTAATCATTCCATTCCTTTGTATCAAATAATA
TCCCACTTCCTGGTTACCTCTCCAGCAACCGTTCCCCCATCCCACGTATTCCCCCCTCCCCTTTGCCTGTATGAGGGTGC
TTCCTCACCCACCCATCCTCTCCCTCCCCCTCCTGTATTCTTTTATTTTGGGTTTTTTTCCAAGGCAGGGTTTCTCTGTG
TAGAGCTGGCTGTTCTGGAACTTTATATACCAGGCTGACCTCAAACTCACAGAGAGCTACCTCTACCTTCCGAGTGCTGG
GATAATTGCCTACCTCAACTGTATT
Sequence Type genomic DNA
Unitrap ID UNI12914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3360927..3361430 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069806 (Cacng7) NM_133189 calcium channel, voltage-dependent, gamma subunit 7 Gene [Source:MGI Symbol;Acc:MGI:1932374]

 
Come back to gene ENSMUSG00000069806


For any suggestions or comments, please send an email to unitrap@crg.es