Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD150C11
Clone ID 3SD150C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD150C11
Sequence
CCCACGCAGACCGATCTTGATATGTCAGAGTGGAGATAGAGAAGGGTGTCTTGTCTTATTCTTCCCCAGGCAGTAGTAAT
GGAGAGGGTATCTATTACTGAGTGCAAGGAGAGATTAGAGGGCTCCCTGATAGCTATCTCTGGTCCCCTTGTGGCTTTTC
CTTGCTGCTTCCAGGTTCTTCCTTCCCTTTTGGCCCTTGCCATTCAGCCATCCTTTGGTAGACTGCCAAG
Sequence Type genomic DNA
Unitrap ID UNI518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114671522..114671750 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042348 (Arl15) NM_172595 ADP-ribosylation factor-like 15 Gene [Source:MGI Symbol;Acc:MGI:2442308]

 
Come back to gene ENSMUSG00000042348


For any suggestions or comments, please send an email to unitrap@crg.es