Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP098F02
Clone ID 3SP098F02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP098F02
Sequence
ATGCTTGGGATGCAGCAAGTTTGAAATACTAAGTCCCGAGAAAGGCAGCTTNNGAGGCCAACTATCAGGATGCTGGTGGT
GTGCAGAGTGGAAGCCTGGCCGGCAGANNCTGGGCGCCTNNNGTTTGGGCGCAGATGTGTCAGATACATTTTTAGTGTAG
ATTTCCGAGAGTGGAAAGAGGGAAGCGGGCCNCAGGGAGTTATGGCGGGGTAAAAGAAATGCCTGATGGTCAACCCAGCT
GAAATAGACGGAAGGACCAGGGTGCTCTGGGAGCTCAGTCCAGTTCCCGTGGCACCATAGAGAATCCTAACAACTTGTTG
AAGTTTGTGAGGTTCCACTGATACTGAGGCAGCCTTTCTGCATATTTGGTTGTGATTGTGGAGTTTGTGCTGTGCCCCCC
CGCGGTGGGGGCAGGGCAGGGTCCGGGG
Sequence Type genomic DNA
Unitrap ID UNI22386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40215706..40216134 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036822 (Topors) NM_134097 topoisomerase I binding, arginine/serine-rich Gene [Source:MGI (curated);Acc:Topors-001]

 
Come back to gene ENSMUSG00000036822


For any suggestions or comments, please send an email to unitrap@crg.es