Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SP095H11
Clone ID 5SP095H11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP095H11
Sequence
GGTCCACAGTTCTGCAGCGTCCGGTCCATGGTTGGTTGGCCCTGTGACAAGGCAGCACATGTTGATGGGAGCATGT
Sequence Type genomic DNA
Unitrap ID UNI10487

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32020758..32020833 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es