Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SP093C09
Clone ID 3SP093C09
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP093C09
Sequence
GGTTCATTATTNACTCGTTGGATGTTATCTTGGATGTTTTGCGTGTGAAATTTCCATTAACCATGGTACCTGACTGAAAG
AAGCTGTTACTTTGCAAATGGGGAAGGCAAACTTTTTTGTATCCAGAAG
Sequence Type genomic DNA
Unitrap ID UNI11665

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130037985..130038101 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074088 (Wdr57) NM_025645 WD repeat domain 57 (U5 snRNP specific) Gene [Source:MGI Symbol;Acc:MGI:1913835]

 
Come back to gene ENSMUSG00000074088


For any suggestions or comments, please send an email to unitrap@crg.es