Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SM123B03
Clone ID 3SM123B03
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SM123B03
Sequence
GTATTGTAATTGCAATACAAAAGACCTGTACATAGTCACTTCAGCAATGGCTGTAAATATGGCTTATCCACCGTGCTTGA
TAGTATCAACTGCTTCATGCTCCACTCTTTGTTCTAGATCTTTGCTGTAGCTATGACCACATGTAGCCACTCAAAATGTA
AACAGATTAAAATGTAG
Sequence Type genomic DNA
Unitrap ID UNI4921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8505049..8505225 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073468 (Sft2d1) SFT2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918689]

 
Come back to gene ENSMUSG00000073468


For any suggestions or comments, please send an email to unitrap@crg.es