Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SH006D08
Clone ID 5SH006D08
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH006D08
Sequence
GATCTGTCTCCCTTGGTCATGGACAGGTGCTTCAAGAGCCAAAGTCAAAAGTCTTATACCAGGGCATGAA
Sequence Type genomic DNA
Unitrap ID UNI36954

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11495869..11495938 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062511 (4930512M02Rik) RIKEN cDNA 4930512M02 gene Gene [Source:MGI Symbol;Acc:MGI:1922360]

 
Come back to gene ENSMUSG00000062511


For any suggestions or comments, please send an email to unitrap@crg.es