Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE386G12
Clone ID 5SE386G12
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE386G12
Sequence
GATCTCTGGAGGCTAGCTTGGTCTCCAGAGGAAAAGAAAAAAAAAGGAAGGAGGAACGAAGAGGAAAGGAGACTTACTTT
TCATAATAGTTTAC
Sequence Type genomic DNA
Unitrap ID UNI27883

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95146036..95146130 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015697 (Setdb1) NM_018877 SET domain, bifurcated 1 Gene [Source:MGI (curated);Acc:Setdb1-005]

 
Come back to gene ENSMUSG00000015697


For any suggestions or comments, please send an email to unitrap@crg.es