Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD142A11
Clone ID 3SD142A11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD142A11
Sequence
GTGGGGACTGCAGTTGTTATCCTGAAATAAATCATAATGAACTGAGCATCTGCAGAGACATATAAACCATTTTGATCACC
TGAATTCACAGAG
Sequence Type genomic DNA
Unitrap ID UNI31027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17220033..17220125 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067034 (Zfp97) NP_001005358 zinc finger protein 97 Gene [Source:MGI Symbol;Acc:MGI:105921]

 
Come back to gene ENSMUSG00000067034


For any suggestions or comments, please send an email to unitrap@crg.es