Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD142A07
Clone ID 3SD142A07
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD142A07
Sequence
GAAATTGTCACTTTTCTTTGTCCCATGCCTGTTCTTCTCAATACTTAACACCTGTCATGACTCCCAAAGGCAGTCTCAGC
GGCTGAATCCTTTAGAAAACTTTTTTTTTCCCCAAATGGAGACACTGGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI22589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86793511..86793644 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004994 (Ccdc130) NM_026350 coiled-coil domain containing 130 Gene [Source:MGI Symbol;Acc:MGI:1914986]

 
Come back to gene ENSMUSG00000004994


For any suggestions or comments, please send an email to unitrap@crg.es