Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD136C04
Clone ID 3SD136C04
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD136C04
Sequence
GAACAACATTATACCTCTTCATGGGGGGGCAGACCCCACAGAAGCACTGCTGTCCAGAGTCAAGCCATGTGGAGGGCCCG
TCCACCCATCCATTCCATTTCTGAGTAGTTCCTTGTCTGTCTATTCAGCTGTGCCATATAAAATTAGAATAAAATGAAGG
GGAGGGTGTTTGGCATAAAATGATTAAGTGAAGGCTAGAAGTTAAAAATACAAAGCTAAATTATAAGAGTTTTGAAGGGA
TTGGAGTAAAGGTTAAA
Sequence Type genomic DNA
Unitrap ID UNI1428

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45686554..45686810 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006169 (Clint1) NM_001045520 clathrin interactor 1 Gene [Source:MGI (curated);Acc:Clint1-002]

 
Come back to gene ENSMUSG00000006169


For any suggestions or comments, please send an email to unitrap@crg.es