Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD134G05
Clone ID 5SD134G05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD134G05
Sequence
GATCCGCGCCACCTCGCCTGGCTTTCTTGAGGCCAATTTAGAGTTTCAAAAATGTATTACTTTATTATAGCTCTTTGTAC
AACTCGAATATTTGTATTTTATATTTTGTATGTAAGTCAGAGATCAATGGCTATAG
Sequence Type genomic DNA
Unitrap ID UNI36924

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 102527578..102527713 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032534 (AL450317.13) NM_001081122 centrosomal protein 63 [Source:RefSeq peptide;Acc:NP_001074591]

 
Come back to gene ENSMUSG00000032534


For any suggestions or comments, please send an email to unitrap@crg.es