Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST420463
Clone ID OST420463
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST420463
Sequence
GGTTACCTTGGGACAGGTTTACGAGTAGGACAAAGAGAAGATGGATTCTTGNATGTGGCCTACAGCGNAGAGAACACTTT
TGGCTTCTGAGGCCCTTGCTGGGCTAGGTGCGCCCTTCCTGCTTGTGTCTCTTGTAAATAACTGGCTGTTCTCAGTTACT
CTGCCAGAGCCTNCACACAGACCTACTAGTGCATTTGTAACTGGATTTATTTCTTAATATATTCGGAAGGCT
Sequence Type mRNA
Unitrap ID UNI12880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114476223..114476444 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23623992..23624213 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061468 (AC118010.11)  

 
Come back to gene ENSMUSG00000061468


For any suggestions or comments, please send an email to unitrap@crg.es