Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD124B02
Clone ID 5SD124B02
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD124B02
Sequence
TACAATGAATTTTAAGAAGGAGAAAGACTTTTTGCCCATAGGAAGACACCACAGAAATAATGAAGTACAGTTAATTTTTT
TTGGATATTGTGGTGCTGAGCTGGAACCCAGGGTCTTTCTTGCACAGGCTAATCAAGCCCCCTGCCCCCAAAAGCCGCAC
CCCCCAGACTTGGTGCTCAGGGGCTGGAGTGATGGG
Sequence Type genomic DNA
Unitrap ID UNI7184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86114358..86114552 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031708 (1600014K23Rik) NM_134118 glycoprotein, synaptic 2 Gene [Source:MGI Symbol;Acc:MGI:1915408]

 
Come back to gene ENSMUSG00000031708


For any suggestions or comments, please send an email to unitrap@crg.es