Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD116C11
Clone ID 3SD116C11
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD116C11
Sequence
CGGGGAGTTAGGTCAGCAATNGGACAGAGCCTAGAGACTTAAAGTGGAATTGCATCATTCGTAGCAAAAGGAGAAGAGGG
AGATACCGGTTTATACTTCAGCCAGGAGCTGGAAACCGAGCCTGAGACTACCTCAGGAAGGGTAGGTTTAAGACCAGTCA
ACGTTGAGCCTAGATGAGCTGGGGCAGAGTTTAGGCCAGTGGAGGCTAGACAGAAGGGGCAGAACCAGACTACCTGGGGG
TGATAGCTAGACCGCGGAAAAGAATTAAGATGATTAGGATAGAGATGAGCCATTGTCAGCCATTGCCAGAAATCTCAGAA
GGTTAAGATCCCACTAGTGTCGACACCAGTCTCATTCAGC
Sequence Type genomic DNA
Unitrap ID UNI36960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3414022..3414350 326
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053395 (Cacng8) NP_573453 calcium channel, voltage-dependent, gamma subunit 8 Gene [Source:MGI Symbol;Acc:MGI:1932376]

 
Come back to gene ENSMUSG00000053395


For any suggestions or comments, please send an email to unitrap@crg.es