Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE386A11
Clone ID 5SE386A11
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE386A11
Sequence
GATCCAGACTGATTAGATGAGGGCTTCCACAGTGTGTATGGAACAGACAG
Sequence Type genomic DNA
Unitrap ID UNI6398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180439593..180439642 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es