Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SD103B08
Clone ID 5SD103B08
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SD103B08
Sequence
ATAAACGTAGCCTGACTTTTGCTGGGATTCAAGTTAAAGCTCCAGATTCTATAGGAACAAGAAAGACAATGTCAATGTTA
AGTCATAAACTGGGGAAGAACATTATTGTTGTTGTTA
Sequence Type genomic DNA
Unitrap ID UNI30985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135577098..135577214 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es