Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE320B06
Clone ID 5SE320B06
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE320B06
Sequence
GATCTTTGCGTGTGTGGGGGGGTGAGGGTGGAGAGATGGGGGAGGGGAAAGCTGAGTTCAGTTTTTTGTTGTTGTTGTTA
TTGGTTTTTCTTGTTTTTTTGTTTTTTTTGGTTGGTCTTGTTTTTTTGAGACAGGATTTCTCTGTGTAGCCCTGGCTGTC
CTACAACT
Sequence Type genomic DNA
Unitrap ID UNI11369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20821498..20821665 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037405 (Icam1) NM_010493 intercellular adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:96392]

 
Come back to gene ENSMUSG00000037405


For any suggestions or comments, please send an email to unitrap@crg.es