Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SD083H05
Clone ID 3SD083H05
Vector rFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SD083H05
Sequence
TGAATTAGGAGCTGAATGAATGCCTGGCCGGATGCCTGACACACCCTCAAGACTGAGTTACTTGAATGTATGAATGAACT
GGCCCTGAGAATTTGCTGAATGTAAACCCAGCTTGCCCCTNNCCCCAAGCCAGCCCCTTCTGAGCCCCTCCTCAGTGAGA
TGCTAATACTCAGAGCTTTAGCTGCTGGGCCACTGGCTTGGGATGCAGCCCGAAGNNGAAGACTTAAGCAAGCAGCCGAG
TCTAATTAGAAAATGAGACCTCGCAGAGGAATAGGATTAAACTCACCACTGGTTGGAGGCATAGTCCTGGAGCTTCCTCC
ATATGTGGGGCTACTGCCTCGTGTGTCCTCTGTCGATCTTCACAGTGGGTGGCAGACTTGCTCCTGGCCCATTCGCAGAT
GCTATGGTCAGTGCCAAGCACCCTCCTGTGGGTCCAGGGTCCTCAGGGGTTGCTACACTTTCGGAGGCTATCCTGGGTAG
CAGGTGATTCTTGTTTGCAGACCCTTCCAGATGGTACAGCCATGTGGACTACCCACTCCTCTTAAAGCTCCCTTCCCCTT
GTTCTCTCCGCAGCTTGCCCGGCACCCAGAAGAGGTTACTGAGCCCCNNNCCATGGTCCCCTCTCGCAGGACGTGGAACT
TGGGAGCCACGCCTTCACTGCGAGGCCTGTGGAGAGTGGGCCGGGTCCAGG
Sequence Type genomic DNA
Unitrap ID UNI16704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 97661902..97662592 671
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031788 (Kifc3) NP_034761 kinesin family member C3 Gene [Source:MGI Symbol;Acc:MGI:109202]

 
Come back to gene ENSMUSG00000031788


For any suggestions or comments, please send an email to unitrap@crg.es