Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE314F07
Clone ID 3SE314F07
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE314F07
Sequence
CCTTAGGGGTTCGATTTTCCTTTACTAGTTTATTTAAAGGGCGTCACTGATTTCCTGTAGGGGTTCTTGATGGGGGGTGG
GAGGATGCTGTAGCGAATTTTCAGTTCAGGTATTTGAAATGCCTGGCAAATGTAGGCATAGGGAAGTTGCTTTGTTAAAT
CTGTTTGATTAGCACTTCTTTCCTCCCAGCCCTTGGTTCTTATCCTGAGCAGTGTGGCAGCTTATATGAATTGGTCGGGG
GTTGAGGGAGAACTAACTATCTTGCTGGCCTCCTTGTCTTGCAACACTGTAACGCTGGCAGATAGAGGAGACCGGCTATC
AGTTGTAGAACAGACAAGCCTCCTGGCTGCCTACCCTGGAGAAAGGAGATTCAGGTCCCCAGGAGTTATGACTGTCTGCC
CTCAGGTCCAGAGGGAAAGCACATCGGTATCTTTTCCAGATGAGTCTTTTGTGAAGTGGCCTATCCGTCTTCAACTTCCT
GTTTCTTTTCCCTTGGCCTGTAGTATGATGGTTCAAGACCTTTTGAGGTGACAGAAACTCTAGAAACCTGGGGTGAAAGG
TGAGGTAGCGTGTGGGCTTCTAAAATGACAGACTAGGAGCAGAAATGGGGTACTTGGGGCTCCCCTAGAGCACTGTGCAC
GTGCACACACACACAAACACACACACATCGCAGGACGTGGAGGTAGAAACGCAGACTCCAGTGGGGAGGGATTGCTC
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22409860..22410565 698
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es