Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 5SE314D09
Clone ID 5SE314D09
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 5SE314D09
Sequence
GGATCCTAAGGAGAAATCAGAATTTGAAAGGGTATGCTCTTTAGTTAGTGAGATTTCTGTAGCTTTAAATCAGGCCTCCT
GAGAGTGATGGCTAGAATCTGCTTAGAATGGAATTCTGATGCTGCCTCTGCTAGTTGGCTTTGTATGATCCTAGGCAAGA
TTCTTCAGCATTATCAATCCCAGCTTCATTTGTAAGCCTCTGTTTGAGACAGCATCTCCCCATGCAACTCATTGAATTTT
CCAGTCTGGAATTAAAGGTGTAGATTTGCCCCCCCTCCCCTGGCCATTGTAAGCCCATTCCCCCCCTCTTTCCCCCCCCC
TTTTTTTTTCCTTTCCCCCTCCGTAGCCCTGGCTGTCCTGGAACTAGCTCTGTAGATCAGGGTGGCTTCAAACTCAGACC
CACCTGCTTTTGCCTCCCTGGTGCACTACAATGTCTGGCTATTCCATTATTTGGGAAATAATGTCCCATGC
Sequence Type genomic DNA
Unitrap ID UNI12755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108549261..108549730 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es