Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0008
Clone ID BA0008
Vector pGT2lxf
Project sanger

Sequence tag BA0008
Sequence
GGAAATGGAGTGCTCCCAAGCGTGTCAGAAGAAAAGGTTTCTCCCACCAGAGCCCGGAACATGAAGGACTTTGAAAACCA
AATCACTGAGCTGAAGAAGGAGAACTTCAATCTAAAGCTCCGGATCTACTTCCTGGAGGAGAGAATCCAGCAGGAGTTTG
CTGGCCCCACCGAGCACATCTACAAGACGAACATTGAACTCAAGGTGGAAGTGGAAAGTCTGAAGCGCGAGCTCCAGGAG
AAAGATCAGTTGCTCGTCAAAGCCTC
Sequence Type mRNA
Unitrap ID UNI2844

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70037827..70062351 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]

 
Come back to gene ENSMUSG00000039298


For any suggestions or comments, please send an email to unitrap@crg.es