Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone 3SE314A06
Clone ID 3SE314A06
Vector rsFROSAbgeo+1s
Project ggtc

SPLK-Sequence tag 3SE314A06
Sequence
GGGTTCGGTATGGATGGTTAGGAGAGTCCGTGATGCCCTCCCTCCGGGTGCAAGCGCTGGCCTACATTGTGCAATGAATG
GCTTGGNTTTGTCATGTATCTATCTAGTGTGAGAGCCCCAGTCGGAGAGCAAATTAAATTGGAAGATTTGACCGTCGAAC
GTTTCAACCATACCCAATCTTAGTGCCCCGGTTCTTTTGCTTTAAAGAGTTAACCTTAGAAACACCTTTGTGGCTGGTCT
CCAACCTGACTCACAGGTGAGCAGGGAGTACTCCTTAACACTTTCCACTGCAGAAAACATTCTGAACATTATTAAACCAC
TTAGTTTCCTTGTTCTGCAACTAAAATGAGCAAAAAGATAGTGCTGTTTAAGCAGTTGAGGAGGACGGGCAGAAAGGAAC
TAAGGATGTTTAAAGATTGTAGTTGAGTTTGGACATTATGTTAGGCTGATGTGAACTTCTAGTTCACAAAACTGCCAAGT
TTGTTTTTCTTTTGTTTATTGGTTATAGCCTTAAACTGTGCAACCTAGGTTAGCCTTGAAATGGCTGGCTGTCTAGACTG
CTTGCTTGCTCTAACCTACTTTTTAAAAAAATAAGTTCCAAATTATAGGGCATTAATTCAAGCTACCAAAATGCTCAGTC
TGCCCTCCCCACCCCCTTTCTTTTCCTTTCCTTTTCTTTTTTTGAGATAGGGTCTTACTGTGTAGCCTTGTCTGGCCTCG
AACTCCGTGGACCAGGCTGTCCTTGAAGTTACAGA
Sequence Type genomic DNA
Unitrap ID UNI7671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102825393..102826142 732
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068823 (Csde1) NM_144901 cold shock domain containing E1, RNA binding Gene [Source:MGI Symbol;Acc:MGI:92356]

 
Come back to gene ENSMUSG00000068823


For any suggestions or comments, please send an email to unitrap@crg.es