Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517D9-5S
Clone ID CMHD-GT_517D9-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_517D9-5S
Sequence
GAATTTAAACCCGGTATCGAAATCCCGTCCCCCGAAAAGGCCATTCATCGTGTCCTTTATAATGCTACTGGGGACCTGAG
TGCTGCAGCCCAGCTT
Sequence Type genomic DNA
Unitrap ID UNI13736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106889859..106889954 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078607 (1810010H24Rik) RIKEN cDNA 1810010H24 gene Gene [Source:MGI Symbol;Acc:MGI:1916316]

 
Come back to gene ENSMUSG00000078607


For any suggestions or comments, please send an email to unitrap@crg.es