Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517C10-5S
Clone ID CMHD-GT_517C10-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_517C10-5S
Sequence
AATTTGTTCAACCAATAGAGTCTTCCAAAGTGACGTGGGCACACATCCTGTTCTTCAGAACCTTATGAATGACTAATAAT
AAACGAGAACAGTGAGTGGGAGGGAGCTTAGAGAGGATGAGCCAGGGAAAGAATTAACCAAGTTTCCTTCCCTACTCCCG
CGTTCTTTCCTCTTTGTCCTTTAAACAGGTTTTGGTGAGAATTGTCCATAAGATTACTCGATTCCTGCCTGCTGCTTCCT
CATCTTTGCGCCGTTCCTTTTTCCATGGCAAGACCTGGCTTTCACTTCCAGGATTTTTTTTTTAACTTAATTACTTAATT
CATTTGCAGCTTCTGTTTGGTTTTGGTCTGGTGGTGACCACCTTGCTGGGGCAGGTATCCCCGTGGACAAGGAGAGAAGG
AGGAGGTGGGGAGTGTAGGGAGAAGGTGGAGATAGGAAGGGAAAGAGAAAAGCAACAGATTAATTCCATTGAGATCCACT
CCCTAGTTTAGACTTAGAAAGGATCAAGGCTGAGTGCCAAACTGAATGAGAGCAAGTCTCCAATTCTGAACCAAGGCTTA
GTTGGCTGCGAGTGCTAAACGCACAGGCAAAGCTCAGCGCTGCTAAAACACACAAGCAGAGAACTCCACTGGTGCCCGGC
TGCCTCTGCTGCCTTGATTAGCACTCCCTACACTTAGATTTCAACACGATCTAGCTCCACTTGCTTACTCGACACACTCT
GTGAGAGCTGCCTTAGCTGATAATACAATGAGCGTGTCTTCTTTTGTATTGCTGGACTGTCTCAC
Sequence Type genomic DNA
Unitrap ID UNI23144

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135219401..135220183 765
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es