Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516H11-5S
Clone ID CMHD-GT_516H11-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_516H11-5S
Sequence
AATTTCTCTGTGTAGCCCTGGCTGTCCTGAAACTTGTTTCATAGACCAGGCTGGCCTCGAACTTAAAGAGATCAGCCTGC
TCCGCCTCCTGAGTGCTGGGATTAAAGGCGTGTGCCACCACACTCAGCTTTTGTGAGCCTCTTGACAGAAATACT
Sequence Type genomic DNA
Unitrap ID UNI17332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115125694..115125848 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011884 (Gltp) NM_019821 glycolipid transfer protein Gene [Source:MGI (curated);Acc:Gltp-001]

 
Come back to gene ENSMUSG00000011884


For any suggestions or comments, please send an email to unitrap@crg.es