Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516F2-5S
Clone ID CMHD-GT_516F2-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_516F2-5S
Sequence
GAGAGATAAAGGGTTTCTCTTAGTATAGCCCCAGCTGTCCTGGAACTCTCTGTAGACCAGGCTGGCCTTGAACTCAGAGA
TCCACCTGCCTCTGCTTCCTGAATGCTGGGATTAAAGGAAGTGCGTGCCACCTCGCCCGTCTTATTTGTATATTTTCTTG
TTATGT
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168585634..168585799 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]

 
Come back to gene ENSMUSG00000027547


For any suggestions or comments, please send an email to unitrap@crg.es