Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516C4-5S
Clone ID CMHD-GT_516C4-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_516C4-5S
Sequence
AATTCTTGTTGGCGTGTTAGCATTGACCTGGACATCGGTTTAAAATGGTAATGATCAGTAGCTGCAGGGGGTTGTGGGCG
AATCCTGTTGCCATGTTTCTTGCCAGACTTTCTGCCTTCTAATAGATTTCCAGCTTTCACTTGTCATGGCTGTCATATTG
ATAAATCAGCTACAGGTAGCTTCTTGTATTTATTACCCGTGACCCACCTTCCCCAGTCGATGGCGGTAATTCAGCTTTCA
TTTCAAAGTATAAAGAATGTGCATTGGAAAGGATGTCTTTTCTTCATTAAGTTACGTGGTATGGGTCTCAAGTTTGAGGC
TGAGGTAGGACTGTAAAAGATCATCTACCTGGCTTTCTTCT
Sequence Type genomic DNA
Unitrap ID UNI36974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 46031014..46031369 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020340 (Cyfip2) NM_133769 cytoplasmic FMR1 interacting protein 2 Gene [Source:MGI (curated);Acc:Cyfip2-001]

 
Come back to gene ENSMUSG00000020340


For any suggestions or comments, please send an email to unitrap@crg.es