Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516A12-5S
Clone ID CMHD-GT_516A12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_516A12-5S
Sequence
AATTCTCTGTCTAATTCGCTAGTCAGTTTTTTAAGTTAGGTGGTCTGTTTTCTTGACTGTTAGTCTTTTTATATACTTTA
TATATTCTCTC
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27176156..27176246 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es