Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST420225
Clone ID OST420225
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST420225
Sequence
AACTGAGGGCAGTTATACGACGGCTACGATGAGGAGTATGGCTGTCCCATTCTAGATGAGGATAGGGTTGTCGATGAGTT
AGAGCATCAGATGCAGGAGGGCGGTGTGATTGTGGATTACCACGGCTGTGACTTCTTCCCCGAACGCTGGTTTCATATAG
TGTTTGTGTTGAGAACAGATAATGGTGTATTGTATAAACGACTTGAAACAAGGGGTTATAATGAGAAGAAACTACAAGAC
AATATTCAGTGTGAGATTTTTCAAGTTCTTTATGAAGAAGCCATAGCATCTTACAAAGAAGAAATCGTGCATCAGCTGCC
CAGTAATGAACCAGAACAGCTCGAGGACAATATCAACCAAATCTCAAAATGGATTGAGCAGTGGGTCAAAGATCATAACC
CTTAACTTAGACACTGGCTAGCCAGGCACCACCTCCGTCCATCGTCCCAGATCTTAGGAGGCAGCAG
Sequence Type mRNA
Unitrap ID UNI16543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101434005..101436036 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es