Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517F3-5S
Clone ID CMHD-GT_517F3-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_517F3-5S
Sequence
GCTTCCTGGATGACCAGCCAGCTGAGGTGAAATGGCAAGATCTAGGTCATTGAGAGACCCNGTCTGTCAAAAGCAAGCTG
GGGAAGGAAGGCTGGAGAGATGCTACAGGAGTCTGCTCTATCAACAGACTGCATTTCAGATCCTAGGCAGCCCGCAGATG
CCTGTCCCTCTGTCTTACAGGGATCGGTCTCTCCATCTGGCCTCTGGCCACCTGCACACATATGTGCACACAAACACACA
CAGACAAAAGAGGATGACACCTTTCCTCAGCTTCTGCCTTCCACGTGTGTATGCGTGGTGAGGACATCCCACTCGGATGT
GCATAGATCATGTACTCTGCGTGCCTCTATGTACTCACATGTATACACACACAAATTAAAAAACAAAACACAGCCGGGCG
TGGTGGCACACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTTCGAGACCAGCCTGGTCTACA
AAGTGAGTTCCAGGACAGCCAGGGCTATACAGAAAAATCCTGTCTCGAAAAACCAACAAAAACCAAAAAACTAAAAAAAC
AAACAAAACACTGAAAACATGTTCATACCGAACTTCATACACAATTTTTGTAGCCAAAAAGTAGAAGCAATCCAAATAGC
TGTCAACTGTATAAGTGGATAAATAAATGATGTGACCCAACAATAGTGTTACTTAGGCCTAAAACAGTGAGACAGACTGA
GTTTAGCAGAAGATGGCAGGCAGGACTGAGTGTGGTGGAGCATGCCTTTAACCCTAGCACGCAGGAAGCAGAGGCGGGGG
TTTTGAGCCAGTCAGAGCTTCATAGTGAGATGCTATTTCAAAAAGAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI36791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6072179..6073029 849
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024797 (1110014N23Rik) NM_001081041 RIKEN cDNA 1110014N23 gene Gene [Source:MGI Symbol;Acc:MGI:1915755]

 
Come back to gene ENSMUSG00000024797


For any suggestions or comments, please send an email to unitrap@crg.es