Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_534F7-5S
Clone ID CMHD-GT_534F7-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_534F7-5S
Sequence
GCTTCTGTAAGCAAAAGTAACTAATCTGTTAACTGGTGTGATTCCAGCCTCCCTGCCAGGCAGAGCCCCTCCTCCACCAT
TGAATAGTCCCTGAATGAGATCTCCCCGGGTTGGCGAGGATGCTATCTGCATGCTCTCCACCAAGCTGCTCCCAAGCCCA
CTCCTTAACGGATAGCCAGATTCTATCCTTTATAGATCCCATTAGCCATTTTAGTTTTCTGAACTCCAGCCTGCTGTCTC
ATCCCTGAAGAGTGGATGAGCTGGCTTCATTTGGTCACAGACATTACACGCCTTTCCTTCTCTTCAGGACACCCCTTGAG
AATGTCTCTGATTGCAGCGTAGCTTGCAGAAGAGAAATTGATCTCTGTCTGAAATCCTACGTGTCTCTGGAATACTCAGC
TAGGGGCATCAACCTCCTGGGTCAGGGAGGAAACGATGAGCCCCCGACTGTGAACTCGCAGCCTCTAAAGTTGGTGGGTT
CACAGCCTCATCATACACTCTGATCTGATCTGCTCCCCATTGCAGCAGCCTCCCTGACACCCCCACACCTCACCACACCC
AAGCTTCCGCAGCCCATGAGCTCACCTTGTAACTCGGCAAGGTTTGAGAGCATCTATTCCTGAACCCACACACGCCACCT
GTATCTATCAGAGCAGTGTCTCGGCCTCCCTCCTCCAACCCTGACTACAGTCTGAGCACTGTTTTCTCATGACTCCCAGC
CCAGGGAACTTGGGCATTTGGCCACGGCTGGGGAGGTCACCCCGGTGATTCTCACTGAGGCAGGGAACTCCGGTCCTTTC
TTTTGTCTGACTCTCAGCTCCTACCATTGAACCTGACAGCCTAGATTAGCATCATGTGCCGATAGT
Sequence Type genomic DNA
Unitrap ID UNI15056

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25692280..25693145 856
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es