Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_534B7-5S
Clone ID CMHD-GT_534B7-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_534B7-5S
Sequence
AATTTGCCAGTGATGGGGCTGGAGAGATGGCCCACCAGTTAAGTGCATTGGCTGCTCTTATACAGGGTCGAGGTTTGATC
CCAACATCCACCTGGTGGCTCACAACCATCTGTAACTCCAATTTGATGGCCACAGGCATCAGACACATACATGATGCACA
CATACATACGTTCAGGCAAAACACCAGTATACAGAAACATAAAGGAAAAAAAAAGACCTAAATAATTCACCAGTGAAAAA
GCCTTCACTGAGGCTGGCCTGGAGTACATTGTTGGGGGAACCTAGGGCTACATGTGAGCCTAGACAGCAGAGATTGTGAC
ACTGGGGTCTAGGTAGTTGGCTGGCTTAGCAGGCAGTTTGAAGGTCAGCCGAGTGGGACGCCATTATTAGAAAGGTAAGA
CAGCTGAGAGAGACTGACTGGCTTGCAGAAAGCCACCACCTGGAGGGAGCCAAGGTGTT
Sequence Type genomic DNA
Unitrap ID UNI14313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 42084319..42084777 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025171 (Ubtd1) NM_145500 ubiquitin domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2385092]

 
Come back to gene ENSMUSG00000025171


For any suggestions or comments, please send an email to unitrap@crg.es