Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_523A8-5S
Clone ID CMHD-GT_523A8-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_523A8-5S
Sequence
AATTTTTCAAATCCAAATAGATATAATTAACATTTAATGCCCCTGGTTGGTGCTGGTGGCTGGGCCCATTAAGAGCGCAG
TATTGATTGAGAAGGTGAGCCAGCTGGGCCTGCCGCTAGGCCAGGGGGCAGAGGTGGCTGGAGCCAGGGCTGGCTATGAG
CAGGGCTCCAGCCCAGGTGTGAGGAGTGTGGCAGATGGCCAATCCCCACCCCCCACCAAGGGGATCACTGCAGTACTAGT
GGCCTGCCCACTCTCAGGCCCTGTGGTCTCCAGTACCACTCTGATCTACCTTCCCAC
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117002814..117003110 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es