Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_536C4-5S
Clone ID CMHD-GT_536C4-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_536C4-5S
Sequence
AATTTAGAAGTATATGCAGGACCATTATCTGTCTTTAGCACTAGGGGCTTGCCCCATGCAGCCCAAGCCTCTAAGCAGTG
AGATATGACATGAACTGCTTTTTCCCCTGACAAGGGAGAGGCATGTAGGACACCAGAACTGGTATCGATGGACACATGTA
TATTATTGTAATTTCCCAAAAGCTGGGATATGTGTGACGTCCATTTGACAAACATCTAGGGGTCACAATCCGTGAGGATT
AACGCCCACTGAAGGTGCATTAATAAATTTCCCACATGGTGCCTGTCGCCCTAACTGTACCCTGGGATAGCTACCAGCAG
CAAGTTACGCGCAGGTACAGCCACTTGTATTTTCCCCAGTCTCCTTTTGTTTTCCTTAATGGTGACTTTTGATATGTGAA
AGCAGCAGCTCGTTTGAATGGAATTACCAAGTGACATGTGTTTACATGTTACATAGAATGGTGCTGAACTTGCCTAAAGA
GATCTCTTGTCAGACAACCCTGACTGACATAGCTGCAGATGCCAACCTGGACATAATTCAAATCTAACAAGTACAGTTAA
AGGTATAGTCACTGTGTCCTTATCCCCCTCCCCCTGCCTCTTTCTCAGAAGAGGGCATTGGATTCCATTAGAGATGGTTG
TGAGCCACCCTGTGATGCTGGGAATTGAACTCAGGACCTCTGTAAGAGCAGTCAGTGCTCTGAACTGCTGAGCCATCTCT
CTAGCCCTTTACCTTTCTCTTAATAAGAGTGTTTTTCTGCAGCATGAGAGGTTGAAAGTTATTGGAATATTTTTGAAGAT
AGTGTGTCTCAGCTAATTTAACATGGTAAATGTTCAGAGGTGAGGCGTGATGGTGCATCCCTAGAATCCCAGCTACTCAG
GAGATGGAACTCATGATCATGAGTTCCCAGCCCTGTCCAGCATCATA
Sequence Type genomic DNA
Unitrap ID UNI14525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 3154200..3154846 625
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046201 (Rbm16) RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

 
Come back to gene ENSMUSG00000046201


For any suggestions or comments, please send an email to unitrap@crg.es