Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_536B12-5S
Clone ID CMHD-GT_536B12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_536B12-5S
Sequence
AATTTTGTGGGCAGATTTTGTTACTCCTGTGTATAAACCATTTCGTCGGGGAGAATCCAGTGAGTGGGTGAGCTCTTTGC
TGATTGGTGCTTGCTCCCAGAAACTTTTCTGAGGTGTTTGGGAGTACTGTGCTTAACACCCTTAAACTAAAGGGTGGAGC
TACCACTTAACTATATGTGCGTCTGTAATGGAGGGGTCGTGGCTGAAGCACCCGGATGTGGGTCACATCCTTTCCCTTTG
CTTTGAAGTGTGATAACTACCTTAGCACTGAAAAAGACACTGAAAGATGTATCACTCCCTAGGATAGAGGCTGCATAAGG
AGCCTTGTAGAGCATATCTGAAAGTTAGGAGTCCTTGATAACTGAAATTACAGTTGAAAATGATGTATGCAATTTAAACA
CCATGGCTTTCTCTTAGACCAGATTGGTGCTGGGGTGTTCAAGCATAATCAGTCAATGGTGGCTCATAGATAGCACTGGG
GAGCCTGAGGGGGAAGATTCCAAACGTTTTGGGCCACCCTGGGTTACATGGTTAGACCCTGTCTCAACAAAATAAATAGA
TGAATAAAAACTAAAGATGTGATATTTTCTTTTGGGGGTTTGTCCTTCAATGTCACGCTAAGGAAAAAGCCCCTTCTTCA
GCCAAGAATAAAATGTTTTCGTTATACTAATTTTCAAT
Sequence Type genomic DNA
Unitrap ID UNI25625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22074851..22075528 672
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es