Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_536A4-5S
Clone ID CMHD-GT_536A4-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_536A4-5S
Sequence
AATTCACTCTGTAGATCAGGCTGCTCAGAAATCCGCCTGCCTCTGCCTCTGCTGGGATTAAAGGCGTGCGCCACCATGCC
CGGCTCTTTTCTTTCTTTTTTAAAGAATAGTATGTCACTATGTAGTCCTGGCTGGTCTGGAACTCTCTATGTAGATCAGG
CTGGCCTTGAACTCCCTGAGATACGACTGCTTCTGCTTCCCAAGTGTTGAGACTACAGTTGAAATCACCATAACATGTTT
AAAGTATGAG
Sequence Type genomic DNA
Unitrap ID UNI25496

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88295771..88296020 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es