Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_536A3-5S
Clone ID CMHD-GT_536A3-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_536A3-5S
Sequence
AATTCCATAAATCTTAAACTACATACAAATGTGGAACTCGGCCTCACCTTAGGGAATAATCCACAAGATGTTTGATGGCA
TGCTTTTTATAATATAGTACAAGGAAGCAACTGGCAGTATTTCCATCCACCCACTCTCACATTCATCCGTCCCTCTCCCA
CATCCCCAACTCCTTTAAACTTTCTCTCTGAGCCCGGAGTTACATTAGGACACAGGCCTTTCTGTTGTATAGAGGCTGCT
TGTGGTGCTGAGGGGGCAGCTGAACAGCAGCCGTTTACGGAGCACTATGGTATGCGAAGCCACAGATGCTCGCACACGCT
GGGAGGACTGGGTGGGTATGCAAACTGGCCTGGGAGACCAGGGAGGGAGTGTTTGGAAAGGTGCGATACCTGCAACACAC
AAGGAGGTCCTGCATTGACCCCAGAGTCTCCCAGCCTTACCCTTTAGGGGATGGAAACTGTGGGACTGTTGCAAACATTG
GATGGAGTGGTGAGGTTTGTCCTAGGGTTCAGATTAGAACAGGCTAAGACATGCCGGGGAGGTTTGCCAGTAATGAGGGA
AAAATCTGTTCTAGGGTTGTGGGAGGCACGGTTAGAGAGGAAGGAGTAGAAAGACCATGTGCTGACCCGACAGCGTTGGA
TGGCAGGAGGAGCAAGCTTAGAGAGAACTAGGGTTCTGTTTTAGATATGGTCAACAGATGCTGCAAAGCAAATCTGTTTG
GTGCC
Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101967046..101967770 725
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es