Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_539A8-3S
Clone ID CMHD-GT_539A8-3S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_539A8-3S
Sequence
AGAGCAAGCCGGACTTTTGCAGACTCAGCCCAAGAGTTATAACATTTAAATGCCCCAACCTAGGTTTTATCTATGTTGTA
CTTCAGTAAAACTAGAAGTCCTATAGTTATTCTTCATAAGCAAATTGTAAGGGGAAATGGCTTCCTGTGTTATTTCCCTA
GTTCCTGGTTTAAGACTGCTCCTGGGGACAGTAAGATTGGCTTCTCTTTTTCTCAATTGTGTGTCTATAATCTCTGGTCT
CTGCAGGTTTATTTTCATTCAGTTGCTGACAGACCATGGGTGACCAATGACTAATAGACTTCCGTTGCTCTGGTAAATCT
TGGTTTCTGCAGCCAACATGCTGACCAAGTTTAGCAATCAGAATGCCTCTGAATTAATTAATTAATTAATTATGTGTGCA
GTGCTCTACCTGCATGTATGCCTGC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6075515..6075939 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es