Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_539H1-3S
Clone ID CMHD-GT_539H1-3S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_539H1-3S
Sequence
CAAATACGTAAGATTAAAATGTTGTAGATATTACATTGATGGACTGATAGGGAAAATATAATAGAGAAAACAGTGAATTG
TTGGAATGGTGTCTGAATGAAGGGAGAAGACTCAGGAATAAGTTAGCTTTTTTTAAGACAAAGCCTCACTCTATAGACCA
TGCTGGCCTTGAACTCAGAGATCTGCCTGCCTCTGCCCTCCTGAGTGCTAGGCTTAATGTGTGCACCACTCTTGCCAGCT
AAATTGGCTTTTTAATAGGGTAATATCCTCTGACCGGAGGAATAGAGTGTCAAGACAGGAGTGCAGAGGATGACAGACCC
CGGGTGCAGACCTGCAGGCAGTCCAGCCTTGTATG
Sequence Type genomic DNA
Unitrap ID UNI17281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115537790..115538144 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es