Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_545H11-5S
Clone ID CMHD-GT_545H11-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_545H11-5S
Sequence
AATTCAAGGCCAACTGAAGCCAAACATTGAGACCCTGTCTAAATAAACAAAATAAAACCCAGGCGGAAGCAAAGGCAAGC
CCTGCCAGATGTGGCCTGTGGGGACAGGCACTGACCCTGTGACCCGGCCTGCAAAGAGTGTCAGATCTTTTACTTGAATT
GTTCCAGGGGAACCTGCAGGGTGACTTAAATGTCTCCATTTTACACATGAAAGAACTTGGGCTTGAAAAGGTCACTCAGC
CCAGAAGCAGCAAGCAGCAGGAAGCTCTCATCTCTATGTGTTTCAATTTGAAAAAGTTCTCCTGCTCCTCTGTGGTAGGG
CTGGGACCCAAAGCTCTCCACATGGTACACAAGCGCTCTGCCACTGAGCCACGCCCCCAGCCCCTCCCTGGGGGATTCTA
GGAAGAGGCTCTACTGCTGAGCTGTCCTTTTCCTAGTCCATATGGATCTGCTCTGCGGCAGAGATGAAGCCCTTTTTGTC
TAGGTGTGTGGTGGGTTTGAGTGGTGAGGCATATGGTACGACTCTCTTAACTGGTGGCCACTTGTCCCATCCTCCCTAGC
ACTGTCTGACCCCAGTATTGTGTTCTGTCAGATTCCCTCACCAGGACCACCCAGGTTCTTCTTTTTTAAAGATTGCTTTA
AGTGAATTGGTGTTTTGCCTACATACATGTCTGCACACCATATGTGTGCTGTGTCCAAGAAAGAGCTGAGTTTGGGATGT
TTGTGAGCCACCATCTCAGGGAACCCAACCCAGGCCCTCTGCAAGAAC
Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20326613..20327433 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]

 
Come back to gene ENSMUSG00000062300


For any suggestions or comments, please send an email to unitrap@crg.es