Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_537H8-5S
Clone ID CMHD-GT_537H8-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_537H8-5S
Sequence
AATTTTAAGGGTAGAAGATCTTTGATTTTCTTCACGGATGGGATAAGAT
Sequence Type genomic DNA
Unitrap ID UNI20107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26538794..26538842 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040725 (Hnrnpul1) NM_178089 heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

 
Come back to gene ENSMUSG00000040725


For any suggestions or comments, please send an email to unitrap@crg.es