Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_541E4-5S
Clone ID CMHD-GT_541E4-5S
Vector GepNMDi3
Project cmhd

SPLK-Sequence tag CMHD-GT_541E4-5S
Sequence
AATTTTTAGATTTATTTTATGTGTATGGATGTTTTACCTGTATGTATGTATGTATGTATGTATGTATGTATGCATACTGT
GTGCATGCTTGGTACCCAGAAAGGTGGAGGGCATTGGAACTGGAGTTGCAGATGAGTCACCTTGTGGGTGTTGAGAATCA
AGCCCAGGTTTTCCTGTGTAGTGAGTGCAACTTGCTTTGTAGACCAGACTAGCCTTGAACTCAGAGATCCACCTGCCTCG
GCCTCTCGTGTACTAGTTACACTATTTGTTTTTTTAAGCAGGCAGACACACTCTTTTTTTGACTGATAGAAGTCACAGGC
AACATTTCCTTTCAAAGATAGTGTGCTAACAGAGACTAGTGTCAAAAACACTCAGCAAAGGTTCTCGAAGACAAGCAGTT
GGTGGGTTTCAAAAGCTCATTCAGATATCTATGTCTTATCTCCAGAGTCATTGGAAAGATCAATGTCACAGATTTCATTG
TAT
Sequence Type genomic DNA
Unitrap ID UNI28731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79821685..79822167 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022022 (Mtrf1) NM_145960 mitochondrial translational release factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384815]

 
Come back to gene ENSMUSG00000022022


For any suggestions or comments, please send an email to unitrap@crg.es