Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_519G2-5S
Clone ID CMHD-GT_519G2-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_519G2-5S
Sequence
CAGCTCACTGTATTGAGTAGGTTGGCTACCCAGGGAGCCTCTGGGCTCTACCTGTCCCTGCCTCCCCGTGCTGGGTTATA
GCGAATACCACTGTGGGTGCTGAAGCTCCAAACTCGGGTTCTCACTCCACTAGCGCCATCTCTGCTGAGACACCCTTAGA
CCCCTTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCTTAGGGTATATTTGATCTATTTGTGGATGGGTGAGTGCC
TGCACCTATATGCTTATGGAGTCCAGAAGAGGACACCAGATCCCTGGCGGCTGAAGTTACAGTCATTTGTGGGATGTGGG
TGCTGGAATCTGAACTCTGCTCCTCATGACTGAACAGCAAGGCCTCTCTCTCATCTCAACCATCTTTCCAGTCTATCTTT
TTTTGTTTTTTGAGGTAGCATGTCCCCTGTAGCTCAGGCTGGTCTTAAACTCAAGGCCATCTTCCTCCCTCAGCCTCCTG
GGCTTACAGGTTTGCGCCACCAGTGTGAACATCCAATGTGAACCAGGGCTTTTATATTTATTTGTTTTCCTTTGTTTTGT
TGTTGTTTTTAAGACAACGTTTCACTCTGTAGCTCAGGCTAGCCTCCCAAATGCTAGAATTAAAGACAGGCACCACCATG
CCCAGACATATTTACTGTTTGTTTTTCTTAAGATATATTTTATTTTTTTACTTGTGTATATGTATGCACACATTCATTCA
GATGTCCAGGGAGGCCAGAAGAGGACCCCTTGGAACGAGATTTACAGGCAGTTGTAAGACATCTGATATGGGTGCTGGAA
ACCAAATCCAGGCTCTCTGCCAGAGCAGCAAGTGCTCTTAACTATTGAGCCATCTCTCCAGCCC
Sequence Type genomic DNA
Unitrap ID UNI29412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87922826..87923689 864
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028068 (Iqgap3) NM_001033484 IQ motif containing GTPase activating protein 3 Gene [Source:MGI Symbol;Acc:MGI:3028642]

 
Come back to gene ENSMUSG00000028068


For any suggestions or comments, please send an email to unitrap@crg.es