Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_519D7-5S
Clone ID CMHD-GT_519D7-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_519D7-5S
Sequence
ACCCCATTGTATCCCTTACAAAGAAAAAAAGGTAGGTGTTTTGTTTTTGTTTTGCTTTCTAACTGGGAAATATATAGGTA
TACTTGTATGTGTGTATGTTGTTTATGTTGGCATTCCATTGTATTTAATGGCTATGTTACTTTTATATATGTTCTGGTAT
CTGTAACATACATATACACACATAACCTATATTCACCTCTCATTTCCAGTTCAGTGCAACATTGTTCTTTCTCCCTGTCT
TAGTTATTGTTCTATTGCTGTGCAAAGAAATCAGGACCATGGCAACTCTTGTTAGAGGGAGCATTGGGGAGTTGCTTACA
GTTTAGAGGAGTCCATGGTCATTGTGACAGGGAGCCTGGAGACAGACATGGCAAGCAGAGTGCTGGAGAAGTAGCCGAGA
GCTGCACACTGATCTGGCAGAGAGAAGGCATGGGGCTTGGCATGGGCTTTTCAACCCACAAAGCCAGTGACACACTTCTA
CCAACAAGGCCACACCAACCCTTCTAATCCTTTCAAATGGTGCCACTCCCTAGTGACAATGAACCTCTGCTATTCACTGA
GTGAGAAGCGTAGCTCCCACTTTTGTTTTTGTGTATTGTAAATCAACTCCTTGATCACATAGATGCAGGCTATGTCAGTT
TCAGCCATGTGTTTGGCAGTGGCTGCCAGTTTGATCCCCCAAAAATGTTTCTTGGCCCAAGCCAGTAGGCCCTGTCAACC
TTAGCTGGAAAAAGCTTCAGGAGGAATGAGTAATCCCATAAGTTTCTAGCCTATTATTTAAAGAATATTTGAAGAGGATT
TATAGCATCAGACCACAGTGTTGTTATGCACTACCTTCTCTCAACTGTCCTTCTGTCTTAATTCAGTAAGTATC
Sequence Type genomic DNA
Unitrap ID UNI19842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 137540171..137541042 870
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074212 (Dnajb14) DnaJ (Hsp40) homolog, subfamily B, member 14 Gene [Source:MGI (curated);Acc:Dnajb14-001]

 
Come back to gene ENSMUSG00000074212


For any suggestions or comments, please send an email to unitrap@crg.es