Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_519B12-5S
Clone ID CMHD-GT_519B12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_519B12-5S
Sequence
TGGTCATAATAAGAGAGGCAGAAGCTGGTTAAGAAGGGGAAGGAGGGAACTCCTGACCTGACATCTGATTGTTTGCAACT
ACTGAGTGTACTGTCTGTGTGTCATGAGGGTTGACCACAATACTCCCTACCCACTATGTGTATTTATGAGAACACTGACA
CATTGATAGAGATGTATGCCTATAGTCAGAACACACAGATGTCAATGTGTACATAGGTACAAGCAATGCATGCTTGCACA
TACATGCACATACACCACAGCCAAGATCATGTTAATTTTCCTCTTGGTGAGATTGTGGCAGTGTTGATCATAGTGGTGAC
TACTGTCTCCTGAACTCCTATTTATGACCTGTTATCTTTTTATAGTCACTGTCATTTACTGAATCTTCATGGATACCTGG
GAGGTGGTAGCTAGATCAGCTTCCTTGCCTTTGCACAGATAACCAGTGACTAGTTGTATTTGGATCTCACCGTGGTGGCC
TGCTTCTGAGGCTTGAGGACAGCCTTCTCTCACATGAGTGTATGAGTTCGCACTGTTTCACTGGTCGCTTTCTGTTTCTC
CTGTAGCCAAACAAAGCGAAGACCGAGATGAAGGAGCTTCGTCTGCTCTGTGCCGAAGATGAGCAGATCCGTACTTGCTG
GATGACTGCCTTCAGACTGCTCAAGGTAGAGGACTCAAGGCTGCAGTTGGCTGCACCACATGCAGAGCAAGCAGCTGGAT
GTGGGTCTATCCTGACACAAAAATCCTATGGCATTTCTACCAAATGTGATTTATCAATTGTAGTTGTATATTCTTCATAT
CTAAGATCTCAGAAAGGGTAGAACCAGGTTTTCCAACTTGAGCAATATCAAGTATTGATGGAAACCGATTCTTTTTTGGC
TAAAGACGGAGCTCTGTGCATTGTAGGTCTCTCCTAC
Sequence Type genomic DNA
Unitrap ID UNI29790

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11843633..11844550 914
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020176 (Grb10) NM_010345 growth factor receptor bound protein 10 Gene [Source:MGI (curated);Acc:Grb10-005]

 
Come back to gene ENSMUSG00000020176


For any suggestions or comments, please send an email to unitrap@crg.es